ID: 919771983_919771986

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 919771983 919771986
Species Human (GRCh38) Human (GRCh38)
Location 1:201167478-201167500 1:201167513-201167535
Sequence CCTGAAAAAGCTGTTCTTGGGTT CGTTATCTGCAGGAGTCACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 174} {0: 1, 1: 2, 2: 20, 3: 91, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!