ID: 919773320_919773329

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 919773320 919773329
Species Human (GRCh38) Human (GRCh38)
Location 1:201176878-201176900 1:201176925-201176947
Sequence CCTCCTCTCCTCACCAGAGTGTC CTGAAGGCAATTAACAGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 325} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!