ID: 919808591_919808598

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 919808591 919808598
Species Human (GRCh38) Human (GRCh38)
Location 1:201395501-201395523 1:201395520-201395542
Sequence CCCAGCACTTTGGGAGGCCAAGG AAGGCGGCCGGATCACTTGAGGG
Strand - +
Off-target summary {0: 84285, 1: 209100, 2: 236161, 3: 152470, 4: 88713} {0: 1, 1: 5, 2: 84, 3: 376, 4: 923}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!