|
Left Crispr |
Right Crispr |
Crispr ID |
919808591 |
919808598 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:201395501-201395523
|
1:201395520-201395542
|
Sequence |
CCCAGCACTTTGGGAGGCCAAGG |
AAGGCGGCCGGATCACTTGAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 84285, 1: 209100, 2: 236161, 3: 152470, 4: 88713} |
{0: 1, 1: 5, 2: 84, 3: 376, 4: 923} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|