ID: 919811613_919811620

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 919811613 919811620
Species Human (GRCh38) Human (GRCh38)
Location 1:201412361-201412383 1:201412375-201412397
Sequence CCCCACATATAATTCCTGGTGGG CCTGGTGGGCAGAAGTGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 129} {0: 1, 1: 0, 2: 4, 3: 76, 4: 635}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!