ID: 919811615_919811620

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 919811615 919811620
Species Human (GRCh38) Human (GRCh38)
Location 1:201412362-201412384 1:201412375-201412397
Sequence CCCACATATAATTCCTGGTGGGC CCTGGTGGGCAGAAGTGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85} {0: 1, 1: 0, 2: 4, 3: 76, 4: 635}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!