ID: 919814094_919814098

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 919814094 919814098
Species Human (GRCh38) Human (GRCh38)
Location 1:201426825-201426847 1:201426847-201426869
Sequence CCCTCAATTTTTCACCACAAATC CAGCCCCACATGAAGGTTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 232} {0: 1, 1: 0, 2: 0, 3: 15, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!