ID: 919846929_919846941

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 919846929 919846941
Species Human (GRCh38) Human (GRCh38)
Location 1:201648401-201648423 1:201648432-201648454
Sequence CCTCCGACCCCGCCCTATCGCTC CCCTGCTCTTTCCTTTTTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 155} {0: 1, 1: 0, 2: 4, 3: 51, 4: 523}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!