ID: 919847012_919847015

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 919847012 919847015
Species Human (GRCh38) Human (GRCh38)
Location 1:201648700-201648722 1:201648713-201648735
Sequence CCGAGGTGGAGCTGAGCAGCGGC GAGCAGCGGCGGCGGCGACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 195} {0: 1, 1: 3, 2: 13, 3: 116, 4: 610}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!