ID: 919851357_919851363

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 919851357 919851363
Species Human (GRCh38) Human (GRCh38)
Location 1:201675121-201675143 1:201675144-201675166
Sequence CCCCACCTCTGACCTGGGGATGA CCTTTCCACATGAGATTTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 440} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!