ID: 919856484_919856491

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 919856484 919856491
Species Human (GRCh38) Human (GRCh38)
Location 1:201709653-201709675 1:201709686-201709708
Sequence CCACCAGGGGCCACTGCTGGGGC CTGCAGGGTGTAGCCTCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 392} {0: 1, 1: 0, 2: 0, 3: 25, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!