ID: 919859635_919859640

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 919859635 919859640
Species Human (GRCh38) Human (GRCh38)
Location 1:201730921-201730943 1:201730941-201730963
Sequence CCTACGGAAGTGTTCAGGGTTGG TGGGGGTCCAAAGATGCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 106} {0: 1, 1: 0, 2: 0, 3: 12, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!