ID: 919861677_919861682

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 919861677 919861682
Species Human (GRCh38) Human (GRCh38)
Location 1:201742840-201742862 1:201742872-201742894
Sequence CCACACTTGCTGGATTAACCTCT GCCCCTGCCCTGAGCTTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 117} {0: 1, 1: 1, 2: 2, 3: 44, 4: 363}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!