|
Left Crispr |
Right Crispr |
| Crispr ID |
919866153 |
919866157 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:201784533-201784555
|
1:201784571-201784593
|
| Sequence |
CCTATATGGTAGTTTTTACCTAC |
TTTTTTTTTTTTTTTGAGATGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 0, 3: 11, 4: 143} |
{0: 2999, 1: 17290, 2: 21616, 3: 48511, 4: 122087} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|