ID: 919866415_919866417

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 919866415 919866417
Species Human (GRCh38) Human (GRCh38)
Location 1:201786444-201786466 1:201786463-201786485
Sequence CCAGGAGGAGACCAAGGAGAGGC AGGCGACATTCCCATACCATTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 46, 4: 361} {0: 1, 1: 0, 2: 0, 3: 11, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!