ID: 919887368_919887379

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 919887368 919887379
Species Human (GRCh38) Human (GRCh38)
Location 1:201944681-201944703 1:201944708-201944730
Sequence CCTCCCTCCTTCTCCCTCTTCTT AAGGCTTAAACATAGGTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 117, 3: 1074, 4: 6247} {0: 1, 1: 0, 2: 0, 3: 32, 4: 435}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!