ID: 919895158_919895164

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 919895158 919895164
Species Human (GRCh38) Human (GRCh38)
Location 1:202005039-202005061 1:202005069-202005091
Sequence CCTGCCTGTTCGGGGATATTCTG TGATGGCTTCCTCAAGGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78} {0: 1, 1: 0, 2: 3, 3: 26, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!