ID: 919941037_919941042

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 919941037 919941042
Species Human (GRCh38) Human (GRCh38)
Location 1:202286432-202286454 1:202286468-202286490
Sequence CCCCAATCACTTGTTGAGAAAGA GTGTATCCTCATGTTACAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 242} {0: 1, 1: 0, 2: 5, 3: 48, 4: 359}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!