ID: 919944166_919944170

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 919944166 919944170
Species Human (GRCh38) Human (GRCh38)
Location 1:202307678-202307700 1:202307692-202307714
Sequence CCATCCTCTCTATCCACCAACAA CACCAACAAAGAGGATATATTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 34, 4: 326} {0: 1, 1: 0, 2: 2, 3: 15, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!