ID: 919958097_919958110

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 919958097 919958110
Species Human (GRCh38) Human (GRCh38)
Location 1:202438909-202438931 1:202438951-202438973
Sequence CCCTGTGCCTGGAGGTGACCCCG CTGACCTGGAGATGCTCACAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 207} {0: 1, 1: 1, 2: 2, 3: 27, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!