ID: 919958098_919958112

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 919958098 919958112
Species Human (GRCh38) Human (GRCh38)
Location 1:202438910-202438932 1:202438955-202438977
Sequence CCTGTGCCTGGAGGTGACCCCGA CCTGGAGATGCTCACAGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 144} {0: 1, 1: 1, 2: 3, 3: 38, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!