ID: 919969725_919969732

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 919969725 919969732
Species Human (GRCh38) Human (GRCh38)
Location 1:202567223-202567245 1:202567251-202567273
Sequence CCCCTTAAAGCCCACCCACATAT CTGCTGCTCTAAAAGAAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 124} {0: 1, 1: 0, 2: 3, 3: 45, 4: 455}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!