ID: 919977335_919977344

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 919977335 919977344
Species Human (GRCh38) Human (GRCh38)
Location 1:202621232-202621254 1:202621259-202621281
Sequence CCCTGGAGCTGGATCCTCAGCCT AAGGAGAAAACAAATGAGGGGGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 6, 3: 129, 4: 1185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!