ID: 919981895_919981904

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 919981895 919981904
Species Human (GRCh38) Human (GRCh38)
Location 1:202647035-202647057 1:202647064-202647086
Sequence CCCCAGGCCTGGAGCTGTGGTAC TGGCAGAGCCATGGTGGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 266} {0: 1, 1: 0, 2: 6, 3: 30, 4: 341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!