ID: 919987478_919987487

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 919987478 919987487
Species Human (GRCh38) Human (GRCh38)
Location 1:202685968-202685990 1:202685995-202686017
Sequence CCTGCCAGGAAACCCCCAGGGTA CAAGCACATCCACCAGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 141} {0: 1, 1: 0, 2: 0, 3: 13, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!