ID: 920009215_920009224

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 920009215 920009224
Species Human (GRCh38) Human (GRCh38)
Location 1:202855626-202855648 1:202855675-202855697
Sequence CCTTGGGCACCACTTCTCCACAG GCCGTGGCGAGGGTCACACTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 219} {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!