ID: 920021108_920021118

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 920021108 920021118
Species Human (GRCh38) Human (GRCh38)
Location 1:202957704-202957726 1:202957753-202957775
Sequence CCAAAGATTGTTGGTGGAGGAAC GGCTGTTCCCCGCTGAGAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 103} {0: 1, 1: 0, 2: 1, 3: 8, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!