ID: 920029838_920029844

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 920029838 920029844
Species Human (GRCh38) Human (GRCh38)
Location 1:203030262-203030284 1:203030275-203030297
Sequence CCCTTCTGAGTCCAGGTGTGAGG AGGTGTGAGGTGAGGCTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 186} {0: 1, 1: 0, 2: 12, 3: 93, 4: 734}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!