|
Left Crispr |
Right Crispr |
| Crispr ID |
920065472 |
920065483 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:203266621-203266643
|
1:203266657-203266679
|
| Sequence |
CCCATTCTCAATGAGCTGTTGGG |
CGGGGTGGCAGCTGAGCAGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 131, 1: 1458, 2: 426, 3: 118, 4: 231} |
{0: 1, 1: 3, 2: 80, 3: 584, 4: 2107} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|