ID: 920071711_920071720

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 920071711 920071720
Species Human (GRCh38) Human (GRCh38)
Location 1:203307071-203307093 1:203307124-203307146
Sequence CCAGGGCATCTGCCCCTGGTCCT TTTCCCGAAAAGCCGTCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 411} {0: 1, 1: 0, 2: 0, 3: 2, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!