ID: 920076567_920076578

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 920076567 920076578
Species Human (GRCh38) Human (GRCh38)
Location 1:203341628-203341650 1:203341679-203341701
Sequence CCCACATCAGGTCATGAATATTA GGCTTTCCAGGGGTGAGGTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 176} {0: 1, 1: 0, 2: 0, 3: 26, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!