ID: 920087815_920087820

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 920087815 920087820
Species Human (GRCh38) Human (GRCh38)
Location 1:203430646-203430668 1:203430662-203430684
Sequence CCAGTGGCCTTGGGTCTCCCCAC TCCCCACTGGAGTCACAGGGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!