ID: 920099430_920099445

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 920099430 920099445
Species Human (GRCh38) Human (GRCh38)
Location 1:203507749-203507771 1:203507790-203507812
Sequence CCTGTTTTTCCAAAGGTTACCCA GGAGGCTCGTGGAGAAGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 182} {0: 1, 1: 0, 2: 2, 3: 53, 4: 543}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!