ID: 920099430_920099448

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 920099430 920099448
Species Human (GRCh38) Human (GRCh38)
Location 1:203507749-203507771 1:203507797-203507819
Sequence CCTGTTTTTCCAAAGGTTACCCA CGTGGAGAAGGGAGGGTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 182} {0: 1, 1: 0, 2: 22, 3: 139, 4: 1516}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!