ID: 920102481_920102487

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 920102481 920102487
Species Human (GRCh38) Human (GRCh38)
Location 1:203525998-203526020 1:203526043-203526065
Sequence CCAAAACCTGTCAGTGACTTACT ATGGGAAGAAACAGAATTCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 234} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!