ID: 920117215_920117223

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 920117215 920117223
Species Human (GRCh38) Human (GRCh38)
Location 1:203629374-203629396 1:203629421-203629443
Sequence CCATCGTGGAGGCTCAGAGTGCA ATTTTCAGTAATCTGATTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131} {0: 1, 1: 0, 2: 2, 3: 18, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!