ID: 920131964_920131966

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 920131964 920131966
Species Human (GRCh38) Human (GRCh38)
Location 1:203739121-203739143 1:203739144-203739166
Sequence CCTCAGCACAGAAATCCACATAT CTCAATCATCTTTTTAAGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 265} {0: 1, 1: 0, 2: 3, 3: 29, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!