ID: 920139748_920139753

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 920139748 920139753
Species Human (GRCh38) Human (GRCh38)
Location 1:203800208-203800230 1:203800239-203800261
Sequence CCGGCTTTGACCCAGGTTGCCAT TAAGTTGCCCCATGTGTAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 109} {0: 1, 1: 0, 2: 0, 3: 10, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!