ID: 920172783_920172789

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 920172783 920172789
Species Human (GRCh38) Human (GRCh38)
Location 1:204082048-204082070 1:204082061-204082083
Sequence CCTCTTTTCTTGGCTGGTGGTGG CTGGTGGTGGGGTGTGTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 72, 4: 404} {0: 1, 1: 1, 2: 23, 3: 152, 4: 1318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!