ID: 920176894_920176905

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 920176894 920176905
Species Human (GRCh38) Human (GRCh38)
Location 1:204107683-204107705 1:204107711-204107733
Sequence CCAGGGACCCTCTCCCCCAAAGG CCCAGAGTTGCTCTCCATTGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 21, 4: 254} {0: 1, 1: 0, 2: 1, 3: 12, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!