ID: 920192144_920192156

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 920192144 920192156
Species Human (GRCh38) Human (GRCh38)
Location 1:204200690-204200712 1:204200725-204200747
Sequence CCACACTTCCCAAAGTCTCTGAG CAGGCTAATCAGGGGGTTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 288} {0: 1, 1: 0, 2: 1, 3: 6, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!