ID: 920214859_920214866

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 920214859 920214866
Species Human (GRCh38) Human (GRCh38)
Location 1:204354951-204354973 1:204354966-204354988
Sequence CCCAGCAAGTGTGCCATTCCAGG ATTCCAGGGGATTCTCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 146} {0: 1, 1: 0, 2: 1, 3: 10, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!