|
Left Crispr |
Right Crispr |
| Crispr ID |
920217459 |
920217461 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:204371085-204371107
|
1:204371115-204371137
|
| Sequence |
CCTCAGTGATGCTTGTAACATTT |
TCATTGCCACATGTGGCTCATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 0, 3: 22, 4: 257} |
{0: 1, 1: 1, 2: 4, 3: 47, 4: 561} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|