ID: 920222064_920222070

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 920222064 920222070
Species Human (GRCh38) Human (GRCh38)
Location 1:204411401-204411423 1:204411420-204411442
Sequence CCCGGCTCCATCTCCTTTTTCTT TCTTGACAGTCTCTCAGGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 117, 4: 1104} {0: 1, 1: 0, 2: 0, 3: 8, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!