ID: 920226640_920226644

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 920226640 920226644
Species Human (GRCh38) Human (GRCh38)
Location 1:204443814-204443836 1:204443835-204443857
Sequence CCCTCTGCATCTTGTTTCTCCTT TTTCTATTTCTGCCATGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 64, 4: 713} {0: 2, 1: 0, 2: 2, 3: 43, 4: 479}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!