ID: 920262278_920262281

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 920262278 920262281
Species Human (GRCh38) Human (GRCh38)
Location 1:204697026-204697048 1:204697047-204697069
Sequence CCAGGGCTAGGGTTTTTAAGGGT GTTTTGGAGTGAGCCAAAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 7, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!