ID: 920294014_920294018

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 920294014 920294018
Species Human (GRCh38) Human (GRCh38)
Location 1:204944848-204944870 1:204944863-204944885
Sequence CCTCTTGGCTGGAGTAATCAGGA AATCAGGAGGACACAGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 126} {0: 1, 1: 0, 2: 4, 3: 33, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!