ID: 920304512_920304519

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 920304512 920304519
Species Human (GRCh38) Human (GRCh38)
Location 1:205009978-205010000 1:205010029-205010051
Sequence CCATCTGTTCTATAAATTGGCTT TGTGTCCCAGGGAAGGAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 267} {0: 1, 1: 2, 2: 7, 3: 50, 4: 552}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!