ID: 920327268_920327277

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 920327268 920327277
Species Human (GRCh38) Human (GRCh38)
Location 1:205175377-205175399 1:205175425-205175447
Sequence CCACCGTGCCCGCCAGAAGCTGC AACAAAAATGGATAGAAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 286} {0: 1, 1: 0, 2: 6, 3: 76, 4: 907}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!