ID: 920328524_920328536

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 920328524 920328536
Species Human (GRCh38) Human (GRCh38)
Location 1:205186619-205186641 1:205186657-205186679
Sequence CCCTACCCACTCCTGACCCTGCC TTTGGTCTAATTAAATAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 56, 4: 594} {0: 1, 1: 0, 2: 1, 3: 17, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!