ID: 920362193_920362206

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 920362193 920362206
Species Human (GRCh38) Human (GRCh38)
Location 1:205426748-205426770 1:205426791-205426813
Sequence CCCTTCAGGTTCCAGGATCCTTC CTGATGATGGGTTGCCATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 220} {0: 1, 1: 0, 2: 1, 3: 5, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!